What is Linux?

Linux is an open-source operating system that has become a powerful tool for researchers, especially in fields like bioinformatics, data analysis, and scientific computing. Unlike commercial operating systems, Linux offers:

• Free and Open-Source: No cost, with the ability to modify and share the software
• High Performance: Excellent for handling large datasets and complex analyses
• Flexibility: Supports a wide range of scientific and research tools
• Powerful Command-Line Interface: Enables efficient task automation and data management

Basic introduction to Linux

With a Linux terminal, sometimes called a command prompt, console, or command-line interface you interact with your computer using only text entered via the keyboard, which is executed by hitting the return key.

There are hundreds of different commands, but don’t worry, you only need a handful of commands to get started. Generally, commands follow the format below:

We will work through some of the most commonly used command to help get you started.

Printing text

One of the simplest commands is echo which is used to print text on the terminal. Type the command below in the terminal and hit enter:

echo Hello World!

In this example, the command is echo and the argument is Hello World!. The output should look like this:

As you can see, it has printed the text “Hello World!” to the terminal.

Print working directory

To find where we are, we can use the command pwd which is an abbreviation for print working directory.

pwd

Note that commands in Linux and software programs are case sensitive. This means that Pwd is not the same as pwd.

This command prints our location in the Linux system. When we log in, we always start in our home directory which should read as /home/<username>/, where username is specific to you.

Make a directory

Let’s try a new command, mkdir to make a new directory. A directory is just another name for a folder. We will call our new directory “new_directory”.

mkdir new_directory

Note, when naming files or directories, it is best to avoid spaces. Instead, use underscores “_” or hypens “-“ to separate words. Also avoid special characters such as ‘ ? , ( ) ! & * + - ; etc.

List a directory

To see if our directory has been created, we need to use another command ls to list a directory.

ls

Your output should show that your new directory has been created.

This command shows us all the files and directories in our present working directory. Note that your home directory will look different to mine, but it should contain a directory called ‘new_directory’.

Let’s now look an example of using the ls command with the option -l which lists files in long format. Enter the command below:

ls -l

The output should look like this, with one file or directory per line and additional details on the each. A description of the output has been added below.

Changing directory

Once we have set up our new directory, we can use the command cd to change directory.

cd new_directory

Note, you can use autocompletion to save time typing. In this example, you would type “new” and then hit the Tab key, and it will autocomplete the directory name to “new_directory”. This technique can save you a lot of time typing, especially for long commands.

If you have changed directory successfully, you will notice that your prompt have change to include you new directory location.

We can also use pwd again to check our present working directory.

Working with directories

If you think of your directory and other items within it (files sometimes other directories) as a tree, then you can imagine moving between them by moving up or down. Here are some other useful tips to working with directories and moving between files effectively.

As we have already seen, to change to a directory one below you are in, just use the cd command followed by the subdirectory name:

cd subdir_name

To change directory to the one above your are in, use the shorthand for “the directory above” ..

cd ..

You can change to any directory by explicitly stating the full path too

cd /usr/local/bin

If you wish to return to your home directory at any time, just type cd by itself.

cd

or

cd ~

And finally, you can return to the last directory you were working in before this one by typing:

cd -

If you get lost and want to confirm where you are in the directory structure, remember the pwd command.

Redirecting outputs

We can use Linux to redirect the output of a command to a new file. For example, let’s redirect the output of echo to a new file. To redirect an output, we use a special character >, for example:

echo Hello World! > new_file.txt

This command will create a new file called new_file.txt. Remember to avoid using spaces and special characters when creating files or directories. The file suffix .txt just lets us know that this is a text file.

We can check if our new file has been created using ls.

ls

The terminal should look like this:

Now that we have created a new file and can see it is in our working directory, we can print the file to the terminal using cat, which stands for concatenate. This command prints the file to the terminal, and it takes the file name as an argument.

cat new_file.txt

Here we can see that the file “new_file.txt”, contains the text “Hello World!”.

Note that using redirection with “>” overwrites a file. For example, try running the following will change the contents of “new_file.txt” and print the output to the terminal.

echo Hello again! > new_file.txt
cat new_file.txt

However, if we use redirection with “»”, it appends new lines to a file. Try the follow for example.

echo Hello World! > new_file.txt
echo Hello Again! >> new_file.txt
echo This is another line! >> new_file.txt
cat new_file.txt

Moving (renaming) files

Now that we have a file, we can rename the file using mv, which is an abbreviation for move. This command takes two arguments, the original file name and the new file name.

mv new_file.txt another_file.txt
ls

Here, we renamed the file new_file.txt to another_file.txt.

Copying files

If we want to create a copy of a file, we can use the cp which stands for copy. Like the move command, it takes an input file and output file.

cp another_file.txt another_copy.txt
ls

Removing files

Let’s say we are happy with our Linux practice so far and we are ready to start clearing up directory. We can use the rm command to remove unwanted files.

rm another_file.txt
rm another_copy.txt
ls

Removing directories

Now we might want to remove the directory called new_directory. To do this, first we want to change directory back to our home directory.

cd /home/<your_username>/
pwd

We can then try to remove our directory with the following command:

rm new_directory

However, we should get an error message which say’s we cannot remove new_directory because it is a directory.

But this is no problem. To remove directories, we need to specify a special option. To see all options available for a command we can look at the help information using options -h or --help. Try the commands below, both will have the same output:

rm -–help
rm -h

Using -h or --help will print information on the usage and options available for a command. Both -h or --help do the same thing, option specified with -- tend to be more verbose and readable than options specified with - which tend to be more shorthand. Here we can see an option to “remove directories and their contents recursively” which can be specified by -r, -R or –recursive. Let’s try to remove the directory again.

rm -r new_directory

Now the directory has been removed. Note, once you remove a file or directory in Linux, you cannot get it back! There is no recycle bin in Linux! So be very careful with removing important files.

Creating text files with nano

It is possible to create and edit files using text editors in Linux. For the training, we will use nano although there are lots of different options available.

Let’s create a new text file called “rbcl.fasta” using nano.

nano rbcl.fasta

The nano command takes the name of the file that you want to create or edit as an input argument. When you run the command, the nano text editor will open and will look like this:

Let’s paste in some sequence information. Below is a fasta file for the rbcL gene in Arabidopsis thaliana. Copy this and paste it into the nano text editor. Note, to paste text into a terminal, right click the terminal where you want to paste the text. You can also paste text using the keys “Ctrl + V” in Windows or “Command + V” in Mac.

>NC_000932.1:54958-56397 Arabidopsis thaliana chloroplast, complete genome
ATGTCACCACAAACAGAGACTAAAGCAAGTGTTGGGTTCAAAGCTGGTGTTAAAGAGTATAAATTGACTT
ACTATACTCCTGAATATGAAACCAAGGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGG
AGTTCCACCTGAAGAAGCAGGGGCTGCGGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTGTGG
ACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGACGATGCTACCACATCGAGCCCGTTCCAGGAGAAG
AAACTCAATTTATTGCGTATGTAGCTTATCCCTTAGACCTTTTTGAAGAAGGTTCGGTTACTAACATGTT
TACCTCGATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGGCTGCTCTACGTCTAGAGGATCTGCGAATC
CCTCCTGCTTATACTAAAACTTTCCAAGGACCACCTCATGGTATCCAAGTTGAAAGAGATAAATTGAACA
AGTATGGACGTCCCCTATTAGGATGTACTATTAAACCAAAATTGGGGTTATCCGCGAAAAACTATGGTAG
AGCAGTTTATGAATGTCTACGTGGTGGACTTGATTTTACCAAAGATGATGAGAATGTGAACTCCCAACCA
TTTATGCGTTGGAGAGACCGTTTCTTATTTTGTGCCGAAGCTATTTATAAATCACAGGCTGAAACAGGTG
AAATCAAAGGGCATTATTTGAATGCTACTGCGGGTACATGCGAAGAAATGATCAAAAGAGCTGTATTTGC
CAGAGAATTGGGAGTTCCTATCGTAATGCATGACTACTTAACAGGGGGATTCACCGCAAATACTAGTTTG
TCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATCCACCGTGCAATGCACGCTGTTATTGATAGAC
AGAAGAATCATGGTATGCACTTCCGTGTACTAGCTAAAGCTTTACGTCTATCTGGTGGAGATCATATTCA
CGCGGGTACAGTAGTAGGTAAACTTGAAGGAGACAGGGAGTCAACTTTGGGCTTTGTTGATTTACTGCGC
GATGATTATGTTGAAAAAGATCGAAGCCGCGGTATCTTTTTCACTCAAGATTGGGTCTCACTACCTGGTG
TTCTGCCTGTGGCTTCAGGGGGTATTCACGTTTGGCATATGCCTGCTTTGACCGAGATCTTTGGAGATGA
TTCTGTACTACAATTCGGTGGAGGAACTTTAGGCCACCCTTGGGGAAATGCACCGGGTGCCGTAGCCAAC
CGAGTAGCTCTGGAAGCATGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCAGTCGAGGGTAATGAAA
TTATCCGTGAAGCTTGCAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAAGTATGGAAAGAGATCACATT
TAACTTCCCAACCATCGATAAATTAGATGGCCAAGAGTAG

Once you have pasted the text, it will look like this:

Once we are finished editing, we can save our text file by pressing the keys “Ctrl + o”.

Nano will ask you if you would like to write the file to “rbcl.fasta”. Hit the Enter key to save to this file.

To exit nano, press the keys “Ctrl + x”. To check you changes, you can cat the file again:

cat rbcl.fasta

Let’s imagine we wanted to edit the sequence name to something simpler, such as “>arabidopisis_thaliana_rbcl”. To do this, open our file using nano again.

nano rbcl.fasta

To edit the fasta file, use the cursor keys to move to the first line (your mouse will not work here), and remove the first line by pressing the Delete key and replace with “>arabidopsis_thaliana_rbcl”. It should now look like this: